Alphabetized List of Recognition Specificities

All restriction endonuclease recognition specificities available from New England Biolabs are listed below. For enzymes that recognize non-palindromic sequences, the complementary sequence of each strand is listed. For example, CCTC(7/6) and (6/7)GAGG both represent an MnlI (NEB #R0163) site.

All recognition sequences are written 5´ to 3´ using the single letter code nomenclature with the point of cleavage indicated by a "/".

Numbers in parentheses indicate point of cleaveage for non-palindromic enzymes.

For example, GGTCTC(1/5) indicates cleavage at:
5´ ...GGTCTCN/...3´
3´ ...CCAGAGNNNNN/...5´

Recognition SequenceEnzyme
AA/CGTTAclI
A/AGCTTHindIII HindIII-HF®
AAT/ATTSspI SspI-HF®
/AATTMluCI Tsp509I
A/CATGTPciI
A/CCGGTAgeI AgeI-HF®
ACCTGC(4/8)BspMI BfuAI
A/CCWGGTSexAI
A/CGCGTMluI MluI-HF®
ACGGC(12/14)BceAI
A/CGTHpyCH4IV
ACN/GTHpyCH4III
(10/15)ACNNNNGTAYC(12/7)BaeI
(9/12)ACNNNNNCTCC(10/7)BsaXI
A/CRYGTAflIII
A/CTAGTSpeI SpeI-HF®
ACTGG(1/-1)BsrI
ACTGGG(5/4)BmrI
A/GATCTBglII
AGC/GCTAfeI
AG/CTAluI
AGG/CCTStuI
AGT/ACTScaI ScaI-HF®
AT/CGATClaI BspDI
ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)PI-SceI
ATGCA/TNsiI NsiI-HF®
AT/TAATAseI
ATTT/AAATSwaI
(11/13)CAANNNNNGTGG(12/10)CspCI
C/AATTGMfeI MfeI-HF®
CACGAG(-5/-1)BssSI BssSαI
CACGAGNb.BssSI
CACGTC(-3/-3)BmgBI
CAC/GTGPmlI
CACNNN/GTGDraIII DraIII-HF®
CACNN/NNGTGAleI
CAGCAG(25/27)EcoP15I
CAG/CTGPvuII PvuII-HF®
CAGNNN/CTGAlwNI
CAGTG(2/0)BtsIMutI
NNCASTGNN/TspRI
CA/TATGNdeI
CATG/NlaIII
C/ATGCviAII
/CATGFatI
CAYNN/NNRTGMslI
CC(12/16)FspEI
CCANNNNN/NNNNTGGXcmI
CCANNNNN/NTGGBstXI
CCANNNN/NTGGPflMI
CCATC(4/5)BccI
C/CATGGNcoI NcoI-HF®
CCCAGC(-5/-1)BseYI
CCCGC(4/6)FauI
CCC/GGGSmaI
C/CCGGGXmaI TspMI
(0/-1)CCDNt.CviPII
CCDG(10/14)LpnPI
CCGC(-3/-1)AciI
CCGC/GGSacII
CCGCTC(-3/-3)BsrBI
C/CGGMspI HpaII
CC/NGGScrFI
/CCNGGBssKI StyD4I
C/CNNGGBsaJI
CCNNNNN/NNGGBslI
C/CRYGGBtgI
CC/SGGNciI
C/CTAGGAvrII
CCTC(7/6)MnlI
CCTCAGC(-5/-2)BbvCI
CCTCAGCNb.BbvCI
CCTCAGC(-5/-7)Nt.BbvCI
CCTGCA/GGSbfI SbfI-HF®
CCTNAGC(-5/-2)Bpu10I
CC/TNAGGBsu36I
CCTNN/NNNAGGEcoNI
CCTTC(6/5)HpyAV
CC/WGGBstNI
/CCWGGPspGI
C/CWWGGStyI StyI-HF®
(10/12)CGANNNNNNTGC(12/10)BcgI
CGAT/CGPvuI PvuI-HF®
CG/CGBstUI
C/GGCCGEagI EagI-HF®
CG/GWCCGRsrII
CGRY/CGBsiEI
C/GTACGBsiWI BsiWI-HF®
CGTCTC(1/5)BsmBI
CGWCG/Hpy99I
CMG/CKGMspA1I
CNNR(9/13)MspJI
CR/CCGGYGSgrAI
C/TAGBfaI
CTCAG(9/7)BspCNI
C/TCGAGXhoI PaeR7I TliI
CTCTTC(1/4)EarI
CTGAAG(16/14)AcuI
CTGCA/GPstI PstI-HF®
CTGGAG(16/14)BpmI
C/TNAGDdeI
C/TRYAGSfcI
C/TTAAGAflII
CTTGAG(16/14)BpuEI
C/TYRAGSmlI
C/YCGRGAvaI BsoBI
GAAGA(8/7)MboII
GAAGAC(2/6)BbsI BbsI-HF®
GAANN/NNTTCXmnI
GAATGC(1/-1)BsmI
GAATGCNb.BsmI
G/AATTCEcoRI EcoRI-HF®
GACGC(5/10)HgaI
GACGT/CAatII
GAC/GTCZraI
GACN/NNGTCTth111I PflFI
GACNN/NNGTCPshAI
GACNNN/NNGTCAhdI
GACNNNN/NNGTCDrdI
GAG/CTCEco53kI
GAGCT/CSacI SacI-HF®
GAGGAG(10/8)BseRI
GAGTC(4/5)PleI
GAGTC(4/-5)Nt.BstNBI
GAGTC(5/5)MlyI
G/ANTCHinfI
GAT/ATCEcoRV EcoRV-HF®
/GATCMboI Sau3AI DpnII BfuCI
GA/TCDpnI
GATNN/NNATCBsaBI
G/AWTCTfiI
GCAATG(2/0)BsrDI
GCAATGNb.BsrDI
GCAGC(8/12)BbvI
GCAGTG(2/0)BtsI BtsαI
GCAGTGNb.BtsI
GCANNNN/NTGCBstAPI
GCATC(5/9)SfaNI
GCATG/CSphI SphI-HF®
GCCC/GGGCSrfI
GCCGAG(21/19)NmeAIII
GCC/GGCNaeI
G/CCGGCNgoMIV
GCCNNNN/NGGCBglI
GCGAT/CGCAsiSI
GCGATG(10/14)BtgZI
G/CGCHinP1I
GCG/CHhaI
G/CGCGCBssHII
GC/GGCCGCNotI NotI-HF®
GC/NGCFnu4HI
GCN/NGCCac8I
GCNNNNN/NNGCMwoI
G/CTAGCNheI NheI-HF®
GCTAG/CBmtI BmtI-HF®
GCTCTTC(1/4)SapI BspQI
GCTCTTC(1/-7)Nt.BspQI
GC/TNAGCBlpI
G/CWGCTseI ApeKI
GDGCH/CBsp1286I
GGATC(4/5)AlwI
GGATC(4/-5)Nt.AlwI
G/GATCCBamHI BamHI-HF®
GGATG(9/13)FokI
GGATG(2/0)BtsCI
GG/CCHaeIII PhoI
GGCCGG/CCFseI
GGCCNNNN/NGGCCSfiI
GG/CGCCNarI
G/GCGCCKasI
GGC/GCCSfoI
GGCGC/CPluTI
GG/CGCGCCAscI
GGCGGA(11/9)EciI
GGGAC(10/14)BsmFI
GGGCC/CApaI
G/GGCCCPspOMI
G/GNCCSau96I
GGN/NCCNlaIV
GGTAC/CKpnI KpnI-HF®
G/GTACCAcc65I
GGTCTC(1/5)BsaI BsaI-HF®
GGTGA(8/7)HphI
G/GTNACCBstEII  BstEII-HF®
G/GWCCAvaII
G/GYRCCBanI
GKGCM/CBaeGI
GR/CGYCBsaHI
GRGCY/CBanII
GT/ACRsaI
G/TACCviQI
GTA/TACBstZ17I
GTATACBstZ17I-HF®
GTATCC(6/5)BciVI
G/TCGACSalI SalI-HF®
GTCTC(1/-5)Nt.BsmAI
GTCTC(1/5)BsmAI BcoDI
G/TGCACApaLI
GTGCAG(16/14)BsgI
GT/MKACAccI
GTN/NACHpy166II
/GTSACTsp45I
GTT/AACHpaI
GTTT/AAACPmeI
GTY/RACHincII
GWGCW/CBsiHKAI
R/AATTYApoI ApoI-HF
RCATG/YNspI
R/CCGGYBsrFI BsrFαI
R/GATCYBstYI
RGCGC/YHaeII
RG/CYCviKI-1
RG/GNCCYEcoO109I
RG/GWCCYPpuMI
TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)I-CeuI
TAC/GTASnaBI
TAGGGATAACAGGGTAAT(-9/-13)I-SceI
T/CATGABspHI
T/CCGGABspEI
TCCRAC(20/18)MmeI
T/CGATaqαI
TCG/CGANruI NruI-HF®
TCN/GAHpy188I
TC/NNGAHpy188III
T/CTAGAXbaI
T/GATCABclI BclI-HF
TG/CAHpyCH4V
TGC/GCAFspI
TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)PI-PspI
TGG/CCAMscI
T/GTACABsrGI BsrGI-HF®
T/TAAMseI
TTAAT/TAAPacI
TTA/TAAPsiI
TT/CGAABstBI
TTT/AAADraI
VC/TCGAGBPspXI
W/CCGGWBsaWI
YAC/GTRBsaAI
Y/GGCCREaeI