Enzymes with Nonpalindromic Sequences

All recognition sequences are written 5' to 3' using the single letter code nomenclature. Numbers in parentheses indicate the point of cleavage.

Example, GGTCTC(1/5) indicates cleavage at:
5'...GGTCTCN/...3'
3'...CCAGAGNNNN/...5'

EnzymeRecognition Sequence
AciICCGC(-3/-1)
AcuICTGAAG(16/14)
AlwIGGATC(4/5)
BaeI(10/15)ACNNNNGTAYC(12/7)
BbsI §GAAGAC(2/6)
BbsI-HF®GAAGAC(2/6)
BbvCICCTCAGC(-5/-2)
BbvIGCAGC(8/12)
BccICCATC(4/5)
BceAIACGGC(12/14)
BcgI(10/12)CGANNNNNNTGC(12/10)
BciVIGTATCC(6/5)
BcoDIGTCTC(1/5)
BfuAIACCTGC(4/8)
BmgBICACGTC(-3/-3)
BmrIACTGGG(5/4)
BpmICTGGAG(16/14)
Bpu10ICCTNAGC(-5/-2)
BpuEICTTGAG(16/14)
BsaI §GGTCTC(1/5)
BsaI-HF®GGTCTC(1/5)
BsaXI(9/12)ACNNNNNCTCC(10/7)
BseRIGAGGAG(10/8)
BseYICCCAGC(-5/-1)
BsgIGTGCAG(16/14)
BsmAIGTCTC(1/5)
BsmBICGTCTC(1/5)
BsmFIGGGAC(10/14)
BsmIGAATGC(1/-1)
BspCNICTCAG(9/7)
BspMIACCTGC(4/8)
BspQIGCTCTTC(1/4)
BsrBICCGCTC(-3/-3)
BsrDIGCAATG(2/0)
BsrIACTGG(1/-1)
BssSαICACGAG(-5/-1)
BssSICACGAG(-5/-1)
BtgZIGCGATG(10/14)
BtsαIGCAGTG(2/0)
BtsCIGGATG(2/0)
BtsIGCAGTG(2/0)
BtsIMutICAGTG(2/0)
CspCI(11/13)CAANNNNNGTGG(12/10)
EarICTCTTC(1/4)
EciIGGCGGA(11/9)
EcoP15ICAGCAG(25/27)
FauICCCGC(4/6)
FokIGGATG(9/13)
FspEICC(12/16)
HgaIGACGC(5/10)
HphIGGTGA(8/7)
HpyAVCCTTC(6/5)
I-CeuITAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceITAGGGATAACAGGGTAAT(-9/-13)
LpnPICCDG(10/14)
MboIIGAAGA(8/7)
MlyIGAGTC(5/5)
MmeITCCRAC(20/18)
MnlICCTC(7/6)
MspJICNNR(9/13)
Nb.BbvCICCTCAGC
Nb.BsmIGAATGC
Nb.BsrDIGCAATG
Nb.BssSICACGAG
Nb.BtsIGCAGTG
NmeAIIIGCCGAG(21/19)
Nt.AlwIGGATC(4/-5)
Nt.BbvCICCTCAGC(-5/-7)
Nt.BsmAIGTCTC(1/-5)
Nt.BspQIGCTCTTC(1/-7)
Nt.BstNBIGAGTC(4/-5)
Nt.CviPII(0/-1)CCD
PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleIGAGTC(4/5)
SapIGCTCTTC(1/4)
SfaNIGCATC(5/9)
(1) A HF version of this enzyme is available.
(2) A RE-Mix version of this enzyme is available.