The pCMV-CLuc 2 Control Plasmid is a mammalian expression plasmid that constitutively expresses the secreted luciferase from the Ostrapod Cypridina noctiluca (CLuc) under the control of the CMV promoter.
CLuc can be assayed in the culture medium of mammalian cells expressing Cypridina
CLuc does not use the same substrate as other marine luciferases, e.g., Renilla and Gaussia. Therefore, it is possible to assay both CLuc and GLuc independently in cell culture medium from cells expressing both reporters.
Can be used to generate Neomycin-resistant stable cell lines
The pCMV-CLuc Control Plasmid is a mammalian expression vector that encodes the secreted luciferase from the Ostracod Cypridina noctiluca as a reporter, under the control of the constitutive CMV (cytomegalovirus) promoter. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1). Because it is secreted CLuc can be detected in the culture medium of mammalian cells expressing the reporter gene. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418.
Recommended sequencing primers for pCMV-CLuc 2 Control Plasmid (not available from NEB)
T7 Universal Primer (20-mer)
TAATACGACTCACTATAGGG (863-882)
pBasic Reverse Primer (25-mer)
TCAGAAGCCATAGAGCCCACCGCAT (2732-2708)
CLuc 3´ End Forward Primer (23-mer)
GAGTTCAAGAAAGAATGCTACAT (2515-2537)
CLuc 5´ End Reverse Primer (24-mer)
GTAAGGACAGTCCTGGCAATGAAC (987-964)
Figure 1: Activity of Cypridina Luciferase in supernatants and lysates from a stable CLuc-expressing cell line CLuc activity was measured from 20 µl of cell culture supernatant (500 µl total culture volume) and from 20 µl of cell lysate (100 µl total lysate volume).
Figure 2: The high sensitivity of both the CLuc and GLuc assays allows detection of very small numbers of cells expressing each protein. 20 µl of culture supernatant from the indicated number of cells expressing each reporter were assayed.
DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.
Highlights
CMV promoter: 209-863
CLuc coding: 919-2580
Start codon: 919-921
Stop codon: 2578-2580
Signal peptide: 919-972
Synthetic poly-A site: 2589-2637
Neo promoter (SV 40): 3223-3558
Neomycin resistance gene: 3623-4404
Bacterial replication ori (pMB1): 5738-
Amp resistance: 6769-5909
All pLuc-2 vectors have improved polyadenylation-transcription termination of the luciferase transcript. The polyadenylation signal is a synthetic polyadenylation sequence based on the β-globin gene (4).
The pCMV-CLuc 2 Control Plasmid can be used as a control for assessing the efficiency of transfection in mammalian cells. Plasmids containing other constitutive promoter elements are also available (see Companion Products Sold Separately).
Application Features
Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
CLuc does not use the same substrate as other marine luciferases (e.g. Renilla, Gaussia). Therefore, it is possible to assay both CLuc and GLuc independently in cell culture medium from cells expressing both reporters (3).
The pCMV-CLuc 2 Control Plasmid can be transfected into cells using any standard transfection protocol.
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.)
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.)
This product is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB).
While NEB develops and validates its products for various applications, the use of this product may require the buyer to obtain additional third party intellectual property rights for certain applications.
For more information about commercial rights, please contact NEB's Global Business Development team at gbd@neb.com.
This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.
Licenses
Licensed under certain patents and patent applications from the National Institute of Advanced Industrial Science and Technology ("AIST") for Research and Development Purposes.
For use of the Biolux Cypridina Luciferase Assay Kit, or associated assay reagents, in human diagnosis and measurement in relation to human health, contact busdev@neb.com.
Ineligible item added to cart
Based on your Freezer Program type, you are trying to add a product to your cart that is either not allowed or not allowed with the existing contents of your cart. Please review and update your order accordingly If you have any questions, please contact Customer Service at freezers@neb.com or 1-800-632-5227 x 8.
You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.
Institution Changed
Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.
Sign in to your NEB account
To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.