cloned at NEB recombinant NEBU dil_B 65 No BSA

We are excited to announce that we are in the process of switching all reaction buffers to be BSA-free. Beginning April 2021, we will be gradually transitioning to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. All information on the website has been updated to reflect this change. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT
  • This is a homing endonuclease
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
Catalog # Concentration Size
R0695S 5,000 units/ml 500 units
Please enter a quantity for at least one size
Loading Spinner