PI-SceI
recombinant NEBU dil_B 37 65 Heat BSA

The large size of this product was discontinued on 12/31/2020. The small size will continue to be available.

We are excited to announce that we are in the process of switching all reaction buffers to be BSA-free. Beginning April 2021, we will be gradually transitioning to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. All information on the website has been updated to reflect this change. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence ATCTATGTCGG_GTGC^GGAGAAAGAGGTAAT
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Cut Site: ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
Catalog # Concentration Size
R0696S 5,000 units/ml 250 units
Please enter a quantity for at least one size
Loading Spinner