recombinant neb31 dil_B 37 65 Heat

We are excited to announce that we are in the process of switching all reaction buffers to be BSA-free. Beginning April 2021, we will be gradually transitioning to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. All information on the website has been updated to reflect this change. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence CGTAACTATAACGGTC_CTAA^GGTAGCGAA
  • 100% activity in rCutSmart Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
Catalog # Concentration Size
R0699S 5,000 units/ml 500 units
R0699L 5,000 units/ml 2,500 units
Please enter a quantity for at least one size

Need a custom/large volume order? Contact Us

Bulk packaging may also be available and requested for large recurring orders.
Learn More

Loading Spinner