New England Biolabs is working diligently to ensure we keep our employees and their families safe, while maintaining our business continuity. Despite a "Stay At Home" advisory being put in place in Massachusetts, USA, we are deemed an essential business, and our manufacturing and distribution teams continue to be fully operational. We are continuing to work with our suppliers and distribution partners to ensure uninterrupted access to our products and technical support.

Alphabetized List of Recognition Specificities

All restriction endonuclease recognition specificities available from New England Biolabs are listed below. For enzymes that recognize non-palindromic sequences, the complementary sequence of each strand is listed. For example, CCTC(7/6) and (6/7)GAGG both represent an MnlI (NEB #R0163) site.

All recognition sequences are written 5´ to 3´ using the single letter code nomenclature with the point of cleavage indicated by a "/".

Numbers in parentheses indicate point of cleaveage for non-palindromic enzymes.

For example, GGTCTC(1/5) indicates cleavage at:
5´ ...GGTCTCN/...3´
3´ ...CCAGAGNNNNN/...5´

Recognition Sequence Enzyme
AA/CGTT AclI
A/AGCTT HindIII HindIII-HF®
AAT/ATT SspI SspI-HF®
/AATT MluCI
A/CATGT PciI
A/CCGGT AgeI AgeI-HF®
ACCTGC(4/8) BspMI BfuAI
A/CCWGGT SexAI
A/CGCGT MluI MluI-HF®
ACGGC(12/14) BceAI
A/CGT HpyCH4IV
ACN/GT HpyCH4III
(10/15)ACNNNNGTAYC(12/7) BaeI
(9/12)ACNNNNNCTCC(10/7) BsaXI
A/CRYGT AflIII
A/CTAGT SpeI SpeI-HF®
ACTGG(1/-1) BsrI
ACTGGG(5/4) BmrI
A/GATCT BglII
AGC/GCT AfeI
AG/CT AluI
AGG/CCT StuI
AGT/ACT ScaI-HF®
AT/CGAT ClaI BspDI
ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) PI-SceI
ATGCA/T NsiI NsiI-HF®
AT/TAAT AseI
ATTT/AAAT SwaI
(11/13)CAANNNNNGTGG(12/10) CspCI
C/AATTG MfeI MfeI-HF®
CACGAG Nb.BssSI
CACGAG(-5/-1) BssSI-v2
CACGTC(-3/-3) BmgBI
CAC/GTG PmlI
CACNNN/GTG DraIII-HF®
CACNN/NNGTG AleI-v2
CAGCAG(25/27) EcoP15I
CAG/CTG PvuII PvuII-HF®
CAGNNN/CTG AlwNI
CAGTG(2/0) BtsIMutI
CA/TATG NdeI
CATG/ NlaIII
/CATG FatI
C/ATG CviAII
CAYNN/NNRTG MslI
CC(12/16) FspEI
CCANNNNN/NNNNTGG XcmI
CCANNNNN/NTGG BstXI
CCANNNN/NTGG PflMI
CCATC(4/5) BccI
C/CATGG NcoI NcoI-HF®
CCCAGC(-5/-1) BseYI
CCCGC(4/6) FauI
C/CCGGG XmaI TspMI
CCC/GGG SmaI
(0/-1)CCD Nt.CviPII
CCDG(10/14) LpnPI
CCGC(-3/-1) AciI
CCGC/GG SacII
CCGCTC(-3/-3) BsrBI
C/CGG MspI HpaII
/CCNGG StyD4I
CC/NGG ScrFI
C/CNNGG BsaJI
CCNNNNN/NNGG BslI
C/CRYGG BtgI
CC/SGG NciI
C/CTAGG AvrII
CCTC(7/6) MnlI
CCTCAGC(-5/-7) Nt.BbvCI
CCTCAGC(-5/-2) BbvCI
CCTCAGC Nb.BbvCI
CCTGCA/GG SbfI SbfI-HF®
CCTNAGC(-5/-2) Bpu10I
CC/TNAGG Bsu36I
CCTNN/NNNAGG EcoNI
CCTTC(6/5) HpyAV
CC/WGG BstNI
/CCWGG PspGI
C/CWWGG StyI-HF®
(10/12)CGANNNNNNTGC(12/10) BcgI
CGAT/CG PvuI PvuI-HF®
CG/CG BstUI
C/GGCCG EagI EagI-HF®
CG/GWCCG RsrII
CGRY/CG BsiEI
C/GTACG BsiWI BsiWI-HF®
CGTCTC(1/5) BsmBI Esp3I
CGTCTC BsmBI-v2
CGWCG/ Hpy99I
CMG/CKG MspA1I
CNNNNNNNNNNN/NNNNNNNNNG AbaSI
CNNR(9/13) MspJI
CR/CCGGYG SgrAI
C/TAG BfaI
CTCAG(9/7) BspCNI
C/TCGAG XhoI PaeR7I
CTCTTC(1/4) EarI
CTGAAG(16/14) AcuI
CTGCA/G PstI PstI-HF®
CTGGAG(16/14) BpmI
C/TNAG DdeI
C/TRYAG SfcI
C/TTAAG AflII
CTTGAG(16/14) BpuEI
C/TYRAG SmlI
C/YCGRG AvaI BsoBI
GAAGA(8/7) MboII
GAAGAC(2/6) BbsI BbsI-HF®
GAANN/NNTTC XmnI
GAATGC(1/-1) BsmI
GAATGC Nb.BsmI
G/AATTC EcoRI EcoRI-HF®
GACGC(5/10) HgaI
GACGT/C AatII
GAC/GTC ZraI
GACN/NNGTC Tth111I PflFI
GACNN/NNGTC PshAI
GACNNN/NNGTC AhdI
GACNNNN/NNGTC DrdI
GAGCT/C SacI SacI-HF®
GAG/CTC Eco53kI
GAGGAG(10/8) BseRI
GAGTC(5/5) MlyI
GAGTC(4/-5) Nt.BstNBI
GAGTC(4/5) PleI
G/ANTC HinfI
GAT/ATC EcoRV EcoRV-HF®
/GATC MboI Sau3AI DpnII
GA/TC DpnI
GATNN/NNATC BsaBI
G/AWTC TfiI
GCAATG Nb.BsrDI
GCAATG(2/0) BsrDI
GCAGC(8/12) BbvI
GCAGTG(2/0) BtsI-v2
GCAGTG Nb.BtsI
GCANNNN/NTGC BstAPI
GCATC(5/9) SfaNI
GCATG/C SphI SphI-HF®
GCCC/GGGC SrfI
GCCGAG(21/19) NmeAIII
G/CCGGC NgoMIV
GCC/GGC NaeI
GCCNNNN/NGGC BglI
GCGAT/CGC AsiSI
GCGATG(10/14) BtgZI
G/CGC HinP1I
GCG/C HhaI
G/CGCGC BssHII
GC/GGCCGC NotI NotI-HF®
GC/NGC Fnu4HI
GCN/NGC Cac8I
GCNNNNN/NNGC MwoI
G/CTAGC NheI NheI-HF®
GCTAG/C BmtI BmtI-HF®
GCTCTTC(1/-7) Nt.BspQI
GCTCTTC(1/4) SapI BspQI
GC/TNAGC BlpI
G/CWGC TseI ApeKI
GDGCH/C Bsp1286I
GGATC(4/5) AlwI
GGATC(4/-5) Nt.AlwI
G/GATCC BamHI BamHI-HF®
GGATG(2/0) BtsCI
GGATG(9/13) FokI
GG/CC HaeIII
GGCCGG/CC FseI
GGCCNNNN/NGGCC SfiI
GG/CGCC NarI
GGC/GCC SfoI
G/GCGCC KasI
GGCGC/C PluTI
GG/CGCGCC AscI
GGCGGA(11/9) EciI
GGGAC(10/14) BsmFI
G/GGCCC PspOMI
GGGCC/C ApaI
G/GNCC Sau96I
GGN/NCC NlaIV
GGTAC/C KpnI KpnI-HF®
G/GTACC Acc65I
GGTCTC(1/5) BsaI BsaI-HF®v2
GGTGA(8/7) HphI
G/GTNACC BstEII  BstEII-HF®
G/GWCC AvaII
G/GYRCC BanI
GKGCM/C BaeGI
GR/CGYC BsaHI
GRGCY/C BanII
GT/AC RsaI
G/TAC CviQI
GTATAC BstZ17I-HF®
GTATCC(6/5) BciVI
G/TCGAC SalI SalI-HF®
GTCTC(1/-5) Nt.BsmAI
GTCTC(1/5) BsmAI BcoDI
G/TGCAC ApaLI
GTGCAG(16/14) BsgI
GT/MKAC AccI
GTN/NAC Hpy166II
/GTSAC Tsp45I
GTT/AAC HpaI
GTTT/AAAC PmeI
GTY/RAC HincII
GWGCW/C BsiHKAI
NNCASTGNN/ TspRI
R/AATTY ApoI ApoI-HF
RCATG/Y NspI
R/CCGGY BsrFI-v2
R/GATCY BstYI
RGCGC/Y HaeII
RG/CY CviKI-1
RG/GNCCY EcoO109I
RG/GWCCY PpuMI
TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) I-CeuI
TAC/GTA SnaBI
TAGGGATAACAGGGTAAT(-9/-13) I-SceI
T/CATGA BspHI
T/CCGGA BspEI
TCCRAC(20/18) MmeI
T/CGA TaqI-v2
TCG/CGA NruI NruI-HF®
TCN/GA Hpy188I
TC/NNGA Hpy188III
T/CTAGA XbaI
T/GATCA BclI BclI-HF
TG/CA HpyCH4V
TGC/GCA FspI
TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) PI-PspI
TGG/CCA MscI
T/GTACA BsrGI BsrGI-HF®
T/TAA MseI
TTAAT/TAA PacI
TTA/TAA PsiI-v2
TT/CGAA BstBI
TTT/AAA DraI
VC/TCGAGB PspXI
W/CCGGW BsaWI
YAC/GTR BsaAI
Y/GGCCR EaeI
Loading Spinner