Dam-Dcm and CpG Methylation

DNA methyltransferases (MTases) that transfer a methyl group from S-adenosylmethionine to either adenine or cytosine residues, are found in a wide variety of prokaryotes and eukaryotes. Methylation should be considered when digesting DNA with restriction endonucleases because cleavage can be blocked or impaired when a particular base in the recognition site is methylated.

Prokaryotic Methylation

In prokaryotes, MTases have most often been identified as elements of restriction/modification systems that act to protect host DNA from cleavage by the corresponding restriction endonuclease. Most laboratory strains of E. coli contain three site-specific DNA methylases.

  • Dam methylase–methylation at the N6 position of the adenine in the sequence GATC (1,2).
  • Dcm methyltransferases–methylation at the C5 position of the second cytosine in the sequences CCAGG and CCTGG (1,3).
  • EcoKI methylase–methylation of adenine in the sequences AAC(N6)GTGC and GCAC(N6)GTT.

Some or all of the sites for a restriction endonuclease may be resistant to cleavage when isolated from strains expressing the Dam or Dcm methylases if the methylase recognition site overlaps the endonuclease recognition site. For example, plasmid DNA isolated from dam+ E. coli is completely resistant to cleavage by MboI, which cleaves at GATC sites.

Not all DNA isolated from E. coli is methylated to the same extent. While pBR322 DNA is fully modified (and is therefore completely resistant to MboI digestion), only about 50% of λ DNA Dam sites are methylated, presumably because the methylase does not have the opportunity to methylate the DNA fully before it is packaged into the phage head. As a result, enzymes blocked by Dam or Dcm modification will yield partial digestion patterns with λ DNA.

Restriction sites that are blocked by Dam or Dcm methylation can be un-methylated by cloning your DNA into a dam, dcm strain of E. coli, such as dam/dcm Competent E. coli (NEB #C2925).

Restriction sites can also be blocked if an overlapping site is present. In this case, part of the Dam or Dcm sequence is generated by the restriction enzyme sequence, followed by the flanking sequence. This situation should also be considered when designing restriction enzyme digests.

Eukaryotic Methylation

CpG MTases, found in higher eukaryotes (e.g., Dnmt1), transfer a methyl group to the C5 position of cytosine residues. Patterns of CpG methylation are heritable, tissue specific and correlate with gene expression. Consequently, CpG methylation has been postulated to play a role in differentiation and gene expression (4).

Note: The effects of CpG methylation are mainly a concern when digesting eukaryotic genomic DNA. CpG methylation patterns are not retained once the DNA is cloned into a bacterial host.

Methylation Sensitivity

The table below summarizes methylation sensitivity for NEB restriction enzymes, indicating whether or not cleavage is blocked or impaired by Dam, Dcm or CpG methylation if or when it overlaps each recognition site. This table should be viewed as a guide to the behavior of the enzymes listed rather than an absolute indicator. Consult REBASE , the restriction enzyme database, for more detailed information and specific examples upon which these guidelines are based.

References

  1. Marinus, M.G. and Morris, N.R. (1973) J. Bacteriol. 114, 1143–1150. PMID: 4576399
  2. Geier, G.E.and Modrich, P. (1979) J. Biol. Chem. 254, 1408–1413. PMID: 368070
  3. May, M.S. and Hattman, S.(1975) J. Bacteriol. 123, 768–770. PMID: 1097428
  4. Siegfried, Z. and Cedar, H. (1997) Curr. Biol. 7, r305–307. PMID: 9115385

Legend

Not Sensitive Impaired
Blocked ◇ ol Impaired by Overlapping
◻ ol Blocked by Overlapping ◇ scol Impaired by Some Combinations of Overlapping
◻ scol Blocked by Some Combinations of Overlapping
Single Letter Code
Enzyme Sequence Dam Dcm Cpg
AatII § GACGT/C
AbaSI § CNNNNNNNNNNN/NNNNNNNNNG
AccI § GT/MKAC ◻ ol
Acc65I § G/GTACC ◻ scol ◻ scol
AciI § CCGC(-3/-1)
AclI § AA/CGTT
AcuI § CTGAAG(16/14)
AfeI § AGC/GCT
AflII § C/TTAAG
AflIII § A/CRYGT
AgeI § A/CCGGT
AgeI-HF® § A/CCGGT
AhdI § GACNNN/NNGTC ◇ scol
AleI-v2 § CACNN/NNGTG ◇ ol
AluI § AG/CT
AlwI § GGATC(4/5)
AlwNI § CAGNNN/CTG ◻ ol
ApaI § GGGCC/C ◻ ol ◻ ol
ApaLI § G/TGCAC ◻ ol
ApeKI § G/CWGC ◻ ol
ApoI § R/AATTY
ApoI-HF § R/AATTY
AscI § GG/CGCGCC
AseI § AT/TAAT
AsiSI § GCGAT/CGC
AvaI § C/YCGRG
AvaII § G/GWCC ◻ ol ◻ ol
AvrII § C/CTAGG
BaeGI § GKGCM/C
BaeI § (10/15)ACNNNNGTAYC(12/7) ◻ scol
BamHI § G/GATCC
BamHI-HF® § G/GATCC
BanI § G/GYRCC ◻ scol ◻ scol
BanII § GRGCY/C
BbsI § GAAGAC(2/6)
BbsI-HF® § GAAGAC(2/6)
BbvCI § CCTCAGC(-5/-2) ◇ ol
BbvI § GCAGC(8/12)
BccI § CCATC(4/5)
BceAI § ACGGC(12/14)
BcgI § (10/12)CGANNNNNNTGC(12/10) ◇ ol ◻ scol
BciVI § GTATCC(6/5)
BclI § T/GATCA
BclI-HF § T/GATCA
BcoDI § GTCTC(1/5) ◇ scol
BfaI § C/TAG
BfuAI § ACCTGC(4/8) ◇ ol
BglI § GCCNNNN/NGGC ◻ scol
BglII § A/GATCT
BlpI § GC/TNAGC
BmgBI § CACGTC(-3/-3)
BmrI § ACTGGG(5/4)
BmtI § GCTAG/C
BmtI-HF® § GCTAG/C
BpmI § CTGGAG(16/14)
BpuEI § CTTGAG(16/14)
Bpu10I § CCTNAGC(-5/-2)
BsaAI § YAC/GTR
BsaBI § GATNN/NNATC ◻ ol ◻ scol
BsaHI § GR/CGYC ◻ scol
BsaI-HF®v2 § GGTCTC(1/5) ◇ scol ◻ scol
BsaJI § C/CNNGG
BsaWI § W/CCGGW
BsaXI § (9/12)ACNNNNNCTCC(10/7)
BseRI § GAGGAG(10/8)
BseYI § CCCAGC(-5/-1) ◻ ol
BsgI § GTGCAG(16/14)
BsiEI § CGRY/CG
BsiHKAI § GWGCW/C
BsiWI § C/GTACG
BsiWI-HF® § C/GTACG
BslI § CCNNNNN/NNGG ◻ scol ◻ scol
BsmAI § GTCTC(1/5) ◻ scol
BsmBI-v2 § CGTCTC
BsmFI § GGGAC(10/14) ◻ ol ◻ ol
BsmI § GAATGC(1/-1)
BsoBI § C/YCGRG
BspCNI § CTCAG(9/7)
BspDI § AT/CGAT ◻ ol
BspEI § T/CCGGA ◻ ol
BspHI § T/CATGA ◇ ol
Bsp1286I § GDGCH/C
BspMI § ACCTGC(4/8)
BspQI § GCTCTTC(1/4)
BsrBI § CCGCTC(-3/-3) ◻ scol
BsrDI § GCAATG(2/0)
BsrFI-v2 § R/CCGGY
BsrGI § T/GTACA
BsrGI-HF® § T/GTACA
BsrI § ACTGG(1/-1)
BssHII § G/CGCGC
BssSI-v2 § CACGAG(-5/-1)
BstAPI § GCANNNN/NTGC ◻ scol
BstBI § TT/CGAA
BstEII  § G/GTNACC
BstEII-HF® § G/GTNACC
BstNI § CC/WGG
BstUI § CG/CG
BstXI § CCANNNNN/NTGG ◻ scol
BstYI § R/GATCY
BstZ17I-HF® § GTATAC ◻ scol
Bsu36I § CC/TNAGG
BtgI § C/CRYGG
BtgZI § GCGATG(10/14)
BtsCI § GGATG(2/0)
BtsIMutI § CAGTG(2/0)
BtsI-v2 § GCAGTG(2/0)
Cac8I § GCN/NGC ◻ scol
ClaI § AT/CGAT ◻ ol
CspCI § (11/13)CAANNNNNGTGG(12/10)
CviAII § C/ATG
CviKI-1 § RG/CY
CviQI § G/TAC
DdeI § C/TNAG
DpnI § GA/TC ◻ ol
DpnII § /GATC
DraI § TTT/AAA
DraIII-HF® § CACNNN/GTG ◇ ol
DrdI § GACNNNN/NNGTC ◻ scol
EaeI § Y/GGCCR ◻ ol ◻ ol
EagI-HF® § C/GGCCG
EarI § CTCTTC(1/4) ◇ ol
EciI § GGCGGA(11/9) ◻ scol
Eco53kI § GAG/CTC ◻ scol
EcoNI § CCTNN/NNNAGG
EcoO109I § RG/GNCCY ◻ ol
EcoP15I § CAGCAG(25/27)
EcoRI § G/AATTC ◻ scol
EcoRI-HF® § G/AATTC ◻ scol
EcoRV § GAT/ATC ◇ scol
EcoRV-HF® § GAT/ATC ◇ scol
Esp3I § CGTCTC(1/5)
FatI § /CATG
FauI § CCCGC(4/6)
Fnu4HI § GC/NGC ◻ ol
FokI § GGATG(9/13) ◇ ol ◇ ol
FseI § GGCCGG/CC ◇ scol
FspEI § CC(12/16)
FspI § TGC/GCA
HaeII § RGCGC/Y
HaeIII § GG/CC
HgaI § GACGC(5/10)
HhaI § GCG/C
HincII § GTY/RAC ◻ scol
HindIII § A/AGCTT
HindIII-HF® § A/AGCTT
HinfI § G/ANTC ◻ scol
HinP1I § G/CGC
HpaI § GTT/AAC ◻ scol
HpaII § C/CGG
HphI § GGTGA(8/7)
HpyAV § CCTTC(6/5) ◇ ol
HpyCH4III § ACN/GT
HpyCH4IV § A/CGT
HpyCH4V § TG/CA
Hpy188I § TCN/GA ◻ ol
Hpy99I § CGWCG/
Hpy166II § GTN/NAC ◻ ol
Hpy188III § TC/NNGA ◻ ol ◻ ol
I-CeuI § TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI § TAGGGATAACAGGGTAAT(-9/-13)
KasI § G/GCGCC
KpnI § GGTAC/C
KpnI-HF® § GGTAC/C
LpnPI § CCDG(10/14)
MboI § /GATC ◇ ol
MboII § GAAGA(8/7) ◻ ol
MfeI § C/AATTG
MfeI-HF® § C/AATTG
MluCI § /AATT
MluI § A/CGCGT
MluI-HF® § A/CGCGT
MlyI § GAGTC(5/5)
MmeI § TCCRAC(20/18) ◻ ol
MnlI § CCTC(7/6)
MscI § TGG/CCA ◻ ol
MseI § T/TAA
MslI § CAYNN/NNRTG
MspA1I § CMG/CKG ◻ ol
MspI § C/CGG
MspJI § CNNR(9/13)
MwoI § GCNNNNN/NNGC ◻ scol
NaeI § GCC/GGC
NarI § GG/CGCC
Nb.BbvCI § CCTCAGC
Nb.BsmI § GAATGC
Nb.BsrDI § GCAATG
Nb.BssSI § CACGAG
Nb.BtsI § GCAGTG
NciI § CC/SGG ◇ ol
NcoI § C/CATGG
NcoI-HF® § C/CATGG
NdeI § CA/TATG
NgoMIV § G/CCGGC
NheI-HF® § G/CTAGC ◻ scol
NlaIII § CATG/
NlaIV § GGN/NCC ◻ ol ◻ ol
NmeAIII § GCCGAG(21/19)
NotI § GC/GGCCGC
NotI-HF® § GC/GGCCGC
NruI § TCG/CGA ◻ ol
NruI-HF® § TCG/CGA ◻ ol
NsiI § ATGCA/T
NsiI-HF® § ATGCA/T
NspI § RCATG/Y
Nt.AlwI § GGATC(4/-5)
Nt.BbvCI § CCTCAGC(-5/-7) ◻ scol
Nt.BsmAI § GTCTC(1/-5)
Nt.BspQI § GCTCTTC(1/-7)
Nt.BstNBI § GAGTC(4/-5)
Nt.CviPII § (0/-1)CCD
PacI § TTAAT/TAA
PaeR7I § C/TCGAG
PaqCI § CACCTGC(4/8) ◇ ol
PciI § A/CATGT
PflFI § GACN/NNGTC
PflMI § CCANNNN/NTGG ◻ ol
PI-PspI § TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceI § ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleI § GAGTC(4/5) ◻ scol
PluTI § GGCGC/C
PmeI § GTTT/AAAC ◻ scol
PmlI § CAC/GTG
PpuMI § RG/GWCCY ◻ ol
PshAI § GACNN/NNGTC ◻ scol
PsiI-v2 § TTA/TAA
PspGI § /CCWGG
PspOMI § G/GGCCC ◇ scol ◻ ol
PspXI § VC/TCGAGB
PstI § CTGCA/G
PstI-HF® § CTGCA/G
PvuI § CGAT/CG
PvuI-HF® § CGAT/CG
PvuII § CAG/CTG
PvuII-HF® § CAG/CTG
RsaI § GT/AC ◻ scol
RsrII § CG/GWCCG
SacI § GAGCT/C
SacI-HF® § GAGCT/C ◻ scol
SacII § CCGC/GG
SalI § G/TCGAC
SalI-HF® § G/TCGAC
SapI § GCTCTTC(1/4)
Sau3AI § /GATC ◻ ol
Sau96I § G/GNCC ◻ ol ◻ ol
SbfI § CCTGCA/GG
SbfI-HF® § CCTGCA/GG
ScaI-HF® § AGT/ACT
ScrFI § CC/NGG ◻ ol ◻ ol
SexAI § A/CCWGGT
SfaNI § GCATC(5/9) ◇ scol
SfcI § C/TRYAG
SfiI § GGCCNNNN/NGGCC ◇ ol ◻ scol
SfoI § GGC/GCC ◻ scol
SgrAI § CR/CCGGYG
SmaI § CCC/GGG
SmlI § C/TYRAG
SnaBI § TAC/GTA
SpeI § A/CTAGT
SpeI-HF® § A/CTAGT
SphI § GCATG/C
SphI-HF® § GCATG/C
SrfI § GCCC/GGGC
SspI § AAT/ATT
SspI-HF® § AAT/ATT
StuI § AGG/CCT ◻ ol
StyD4I § /CCNGG ◻ ol ◇ ol
StyI-HF® § C/CWWGG
SwaI § ATTT/AAAT
TaqI-v2 § T/CGA ◻ ol
TfiI § G/AWTC ◻ scol
TseI § G/CWGC ◻ scol
Tsp45I § /GTSAC
TspMI § C/CCGGG
TspRI § NNCASTGNN/
Tth111I § GACN/NNGTC
XbaI § T/CTAGA ◻ ol
XcmI § CCANNNNN/NNNNTGG
XhoI § C/TCGAG
XmaI § C/CCGGG
XmnI § GAANN/NNTTC
ZraI § GAC/GTC

§ An HF version of this enzyme is available.

Loading Spinner