Frequencies of Restriction Sites

The table below summarizes the frequencies with which restriction endonuclease sites occur in commonly used DNA molecules. Detailed restriction maps can be found on DNA sequences and maps. The sites listed in these tables were identified by computer analysis of published sequences. Although we have tried to ensure their accuracy, the sites have not necessarily been confirmed by experimentation. When the same specificity is displayed by several enzymes, the site is listed by the name of the enzyme that is available from New England Biolabs. Other enzymes with the same specificity are listed in the table of isoschizomers. Recognition sequences are written 5´ to 3´.

DNASU is a central repository for plasmid clones and collections that may also be helpful.

Enzyme Recognition Sequence Adeno-2 Lambda** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII § GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI § CNNNNNNNNNNN/NNNNNNNNNG
AccI § GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I § G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI § CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI § AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI § CTGAAG(16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI § AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII § C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII § A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
AgeI § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AhdI § GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 § CACNN/NNGTG 10 20 1 0 1 0 1 0 2 0 8
AluI § AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI § GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI § CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
ApaI § GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
ApaLI § G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI § G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI § GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI § AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI § GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI § C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII § G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII § C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI § GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI § (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BanI § G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII § GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF® § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI § CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI § GCAGC(8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI § CCATC(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI § ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI § (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI § GTATCC(6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI § GTCTC(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI § C/TAG 54 13 5 5 19 3 14 8 8 4 60
BfuAI § ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI § GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII § A/GATCT 11 6 1 0 1 1 2 0 2 0 1
BlpI § GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI § CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI § ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI § CTGGAG(16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI § CTTGAG(16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I § CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI § YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI § GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI § GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 § GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI § C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI § W/CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI § (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI § GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI § CCCAGC(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI § GTGCAG(16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI § CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI § GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF® § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI § CCNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI § GTCTC(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 § CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI § GGGAC(10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI § GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI § C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI § CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI § AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI § T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI § T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I § GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI § ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI § GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI § CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI § GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 § R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI § ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII § G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 § CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI § GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI § TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII  § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® § G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI § CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI § CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI § CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI § R/GATCY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF® § GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I § CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI § C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI § GCGATG(10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI § GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI § CAGTG(2/0) 20
BtsI-v2 § GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I § GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI § AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI § (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII § C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 § RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI § G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI § C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI § GA/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII § /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI § TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® § CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI § GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaeI § Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® § C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
EarI § CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI § GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI § GAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI § CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I § RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I § CAGCAG(25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I § CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI § /CATG 183 181 14 26 38 23 21 23 31 11 148
FauI § CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI § GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI § GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI § GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI § CC(12/16)
FspI § TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII § RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII § GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI § GACGC(5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI § GCG/C 375 215 26 31 36 39 41 46 17 103
HincII § GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI § G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I § G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI § GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII § C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI § GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV § CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III § ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV § A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V § TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I § TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I § CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II § GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III § TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI § TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI § TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
KasI § G/GCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI § CCDG(10/14)
MboI § /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII § GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI § /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MlyI § GAGTC(5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI § TCCRAC(20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI § CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI § TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI § T/TAA 115 195 63 15 41 24 23 32 39 13 207
MslI § CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I § CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI § C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI § CNNR(9/13)
MwoI § GCNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI § GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI § GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI § CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI § GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI § GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI § CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI § GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI § CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI § CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV § G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® § G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII § CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV § GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII § GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
NotI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI § RCATG/Y 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI § GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI § CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI § GTCTC(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI § GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI § GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII § (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI § TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I § C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI § CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PciI § A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI § GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI § CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI § TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI § ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI § GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI § GGCGC/C
PmeI § GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI § CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI § RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI § GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 § TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI § /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI § G/GGCCC 12 1 0 0 0 1 1 1 1 0 0
PspXI § VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® § CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
RsaI § GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII § CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII § CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI § GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI § /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I § G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® § AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI § CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI § A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI § GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI § C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI § GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI § GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI § CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI § CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI § C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI § TAC/GTA 0 1 1 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI § GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI § AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I § /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® § C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
SwaI § ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 § T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI § G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI § G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I § /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI § C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI § NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I § GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI § T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI § CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI § C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
XmaI § C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI § GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI § GAC/GTC 3 10 0 1 0 0 5 1 0 1 1

§ An HF version of this enzyme is available.

 * For M13mp18, only double-stranded regions will be cut.
** Refers to the wild-type DNA substrate; Hind III has 6 restriction sites on the wild-type lambda phage DNA, while NEB’s lambda phage mutant (Lambda DNA, NEB #N3011) has 7 Hind III sites.
Loading Spinner