Why Choose Recombinant Enzymes?

Established in 1975 as a private cooperative of experienced scientists, New England Biolabs is a world leader in the production of restriction endonucleases and related products for recombinant DNA technology. NEB has consistently maintained a position at the forefront of this field, and has successfully linked enzyme production efficiency to basic research in the cloning and overexpression of restriction/modification enzyme systems. This enables NEB to introduce substantial cuts in reagent costs and unsurpassed improvements in product quality and purity. Presently, NEB supplies more than 275 restriction enzymes, over 250 of which are available in recombinant form, as well as numerous recombinant polymerases and modifying enzymes for a wide variety of applications.

Why choose a recombinant enzyme?

Purity

Once an enzyme system is cloned, choice of expression vector and strain background allows tight control over the production environment. For restriction endonucleases, this eliminates enzymes known to contaminate native preparations. For example, when producing AvrII (NEB #R0174) from the native strain Anabaena variabilis, great care must be taken to eliminate AvrI. Similarly, when producing HaeIII (NEB #R0108) from Haemophilus aegyptius, the enzyme must be purified free of HaeII (NEB #R0107). Choice of background strain also plays a key role in eliminating nonspecific endonucleases and exonucleases. Although recombinant enzymes and native enzymes are manufactured to meet the same rigorous quality control standards, it is recombinant enzymes that produce a more pure product with less processing time.

Consistency

Typically, the yields obtained for recombinant and overexpressed enzymes are significantly larger than those produced by native strains. Production of larger lots means greater product consistency and less lot-to-lot variation. Further, this large lot capability is ideal for customers that have a need for bulk quantities of enzymes. It simplifies their quality assurance procedures by reducing the time and effort normally spent to qualify enzymes supplied from different lots.

Affordability

At NEB, the introduction of recombinant enzymes has resulted in lower $/unit charges. Recombinant enzymes with lower $/unit cost allows our customers to experience substantial savings, while benefiting from improved purity and consistency of product.

Advances

Cloning does more than increase product quality and purity. There are many examples where native strains do not produce sufficient levels of desirable enzymes. For example, cloning of enzyme systems such as AvrII (NEB #R0174), BcgI (NEB #R0545), BspHI (NEB #R0517), HgaI (NEB #R0154), KasI (NEB #R0544), and NgoMIV (NEB #R0564) has led to these being commercially available. Also, recombinant enzymes are easier to manipulate at the genetic level often leading to the commercialization of new enzymes with useful biochemical properties. For example, the thermal stable enzyme Vent® DNA Polymerase has a 3´ - 5´ exonuclease. Cloning of the Vent® DNA Polymerase gene led to the production of an exo¯ version of the enzyme that is now widely preferred for DNA sequencing.

We are excited to announce that we are in the process of switching all reaction buffers to be BSA-free. Beginning April 2021, NEB will be switching our current BSA-containing reaction buffers (NEBuffer™ 1.1, 2.1, 3.1 and CutSmart® Buffer) to Recombinant Albumin (rAlbumin)-containing buffers (NEBuffer r1.1, r2.1, r3.1 and rCutSmart™ Buffer). We anticipate that this switch may take as long as 6 months to complete. We feel that moving away from animal-containing products is a step in the right direction and are able to offer this enhancement at the same price. Find more details at www.neb.com/BSA-free.

During this transition period, you may receive product with BSA or rAlbumin-containing buffers. NEB has rigorously tested both and has not seen any difference in enzyme performance when using either buffer. Either buffer can be used with your enzyme. All website content will be switched in April to reflect the changes, although you may not receive the new buffer with your product immediately. 

 Recombinant Enzymes From NEB:

Enzyme Supplied NEBuffer Sequence Properties
AatII § rCutSmart™ Buffer GACGT/C  
AbaSI § @25°C rCutSmart™ Buffer CNNNNNNNNNNN/NNNNNNNNNG
AccI § rCutSmart™ Buffer GT/MKAC  
Acc65I § NEBuffer™ r3.1 G/GTACC   
AciI § rCutSmart™ Buffer CCGC(-3/-1)  
AclI § rCutSmart™ Buffer AA/CGTT  
AcuI § rCutSmart™ Buffer CTGAAG(16/14)  
AfeI § rCutSmart™ Buffer AGC/GCT
AflII § rCutSmart™ Buffer C/TTAAG  
AflIII § NEBuffer™ r3.1 A/CRYGT
AgeI § NEBuffer™ r1.1 A/CCGGT
AgeI-HF® § rCutSmart™ Buffer A/CCGGT  
AhdI § rCutSmart™ Buffer GACNNN/NNGTC  
AleI-v2 § rCutSmart™ Buffer CACNN/NNGTG
AluI § rCutSmart™ Buffer AG/CT  
AlwI § rCutSmart™ Buffer GGATC(4/5)  
AlwNI § rCutSmart™ Buffer CAGNNN/CTG   
ApaI § @25°C rCutSmart™ Buffer GGGCC/C   
ApaLI § rCutSmart™ Buffer G/TGCAC  
ApeKI § @75°C NEBuffer™ r3.1 G/CWGC  
ApoI § @50°C NEBuffer™ r3.1 R/AATTY  
ApoI-HF § rCutSmart™ Buffer R/AATTY  
AscI § rCutSmart™ Buffer GG/CGCGCC  
AseI § NEBuffer™ r3.1 AT/TAAT  
AsiSI § rCutSmart™ Buffer GCGAT/CGC
AvaI § rCutSmart™ Buffer C/YCGRG  
AvaII § rCutSmart™ Buffer G/GWCC   
AvrII § rCutSmart™ Buffer C/CTAGG  
Enzyme Back to top Supplied NEBuffer Sequence Properties
BaeGI § NEBuffer™ r3.1 GKGCM/C  
BaeI § @25°C rCutSmart™ Buffer (10/15)ACNNNNGTAYC(12/7)    
BamHI § NEBuffer™ r3.1 G/GATCC  
BamHI-HF® § rCutSmart™ Buffer G/GATCC  
BanI § rCutSmart™ Buffer G/GYRCC  
BanII § rCutSmart™ Buffer GRGCY/C
BbsI § NEBuffer™ r2.1 GAAGAC(2/6)  
BbsI-HF® § rCutSmart™ Buffer GAAGAC(2/6)  
BbvCI § rCutSmart™ Buffer CCTCAGC(-5/-2)
BbvI § rCutSmart™ Buffer GCAGC(8/12)  
BccI § rCutSmart™ Buffer CCATC(4/5)
BceAI § NEBuffer™ r3.1 ACGGC(12/14)
BcgI § NEBuffer™ r3.1 (10/12)CGANNNNNNTGC(12/10)  
BciVI § rCutSmart™ Buffer GTATCC(6/5)  
BclI § @50°C NEBuffer™ r3.1 T/GATCA   
BclI-HF § rCutSmart™ Buffer T/GATCA   
BcoDI § rCutSmart™ Buffer GTCTC(1/5)  
BfaI § rCutSmart™ Buffer C/TAG
BfuAI § @50°C NEBuffer™ r3.1 ACCTGC(4/8)  
BglI § NEBuffer™ r3.1 GCCNNNN/NGGC  
BglII § NEBuffer™ r3.1 A/GATCT  
BlpI § rCutSmart™ Buffer GC/TNAGC  
BmgBI § NEBuffer™ r3.1 CACGTC(-3/-3)  
BmrI § NEBuffer™ r2.1 ACTGGG(5/4)
BmtI § NEBuffer™ r3.1 GCTAG/C
BmtI-HF® § rCutSmart™ Buffer GCTAG/C  
BpmI § NEBuffer™ r3.1 CTGGAG(16/14)
BpuEI § rCutSmart™ Buffer CTTGAG(16/14)  
Bpu10I § NEBuffer™ r3.1 CCTNAGC(-5/-2)
BsaAI § rCutSmart™ Buffer YAC/GTR  
BsaBI § @60°C rCutSmart™ Buffer GATNN/NNATC  
BsaHI § rCutSmart™ Buffer GR/CGYC   
BsaI-HF®v2 § rCutSmart™ Buffer GGTCTC(1/5)   
BsaJI § @60°C rCutSmart™ Buffer C/CNNGG
BsaWI § @60°C rCutSmart™ Buffer W/CCGGW  
BsaXI § rCutSmart™ Buffer (9/12)ACNNNNNCTCC(10/7)  
BseRI § rCutSmart™ Buffer GAGGAG(10/8)  
BseYI § NEBuffer™ r3.1 CCCAGC(-5/-1)
BsgI § rCutSmart™ Buffer GTGCAG(16/14)  
BsiEI § @60°C rCutSmart™ Buffer CGRY/CG  
BsiHKAI § @65°C rCutSmart™ Buffer GWGCW/C  
BsiWI § @55°C NEBuffer™ r3.1 C/GTACG  
BsiWI-HF® § rCutSmart™ Buffer C/GTACG  
BslI § @55°C rCutSmart™ Buffer CCNNNNN/NNGG   
BsmAI § @55°C rCutSmart™ Buffer GTCTC(1/5)  
BsmBI-v2 § @55°C NEBuffer™ r3.1 CGTCTC  
BsmFI § @65°C rCutSmart™ Buffer GGGAC(10/14)  
BsmI § @65°C rCutSmart™ Buffer GAATGC(1/-1)  
BsoBI § rCutSmart™ Buffer C/YCGRG  
BspCNI § rCutSmart™ Buffer CTCAG(9/7)  
BspDI § rCutSmart™ Buffer AT/CGAT  
BspEI § NEBuffer™ r3.1 T/CCGGA   
BspHI § rCutSmart™ Buffer T/CATGA   
Bsp1286I § rCutSmart™ Buffer GDGCH/C  
BspMI § NEBuffer™ r3.1 ACCTGC(4/8)
BspQI § @50°C NEBuffer™ r3.1 GCTCTTC(1/4)  
BsrBI § rCutSmart™ Buffer CCGCTC(-3/-3)  
BsrDI § @65°C NEBuffer™ r2.1 GCAATG(2/0)  
BsrFI-v2 § rCutSmart™ Buffer R/CCGGY  
BsrGI § NEBuffer™ r2.1 T/GTACA  
BsrGI-HF® § rCutSmart™ Buffer T/GTACA  
BsrI § @65°C NEBuffer™ r3.1 ACTGG(1/-1)  
BssHII § @50°C rCutSmart™ Buffer G/CGCGC  
BssSI-v2 § rCutSmart™ Buffer CACGAG(-5/-1)  
BstAPI § @60°C rCutSmart™ Buffer GCANNNN/NTGC
BstBI § @65°C rCutSmart™ Buffer TT/CGAA  
BstEII  § @60°C NEBuffer™ r3.1 G/GTNACC  
BstEII-HF® § rCutSmart™ Buffer G/GTNACC  
BstNI § @60°C NEBuffer™ r3.1 CC/WGG  
BstUI § @60°C rCutSmart™ Buffer CG/CG  
BstXI § NEBuffer™ r3.1 CCANNNNN/NTGG   
BstYI § @60°C NEBuffer™ r2.1 R/GATCY  
BstZ17I-HF® § rCutSmart™ Buffer GTATAC  
Bsu36I § rCutSmart™ Buffer CC/TNAGG  
BtgI § rCutSmart™ Buffer C/CRYGG  
BtgZI § @60°C rCutSmart™ Buffer GCGATG(10/14)
BtsCI § @50°C rCutSmart™ Buffer GGATG(2/0)  
BtsIMutI § @55°C rCutSmart™ Buffer CAGTG(2/0)
BtsI-v2 § rCutSmart™ Buffer GCAGTG(2/0)  
Enzyme Back to top Supplied NEBuffer Sequence Properties
Cac8I § rCutSmart™ Buffer GCN/NGC  
ClaI § rCutSmart™ Buffer AT/CGAT   
CspCI § rCutSmart™ Buffer (11/13)CAANNNNNGTGG(12/10)  
CviAII § @25°C rCutSmart™ Buffer C/ATG  
CviKI-1 § rCutSmart™ Buffer RG/CY
CviQI § @25°C NEBuffer™ r3.1 G/TAC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
DdeI § rCutSmart™ Buffer C/TNAG  
DpnI § rCutSmart™ Buffer GA/TC  
DpnII § NEBuffer™ DpnII /GATC   
DraI § rCutSmart™ Buffer TTT/AAA  
DraIII-HF® § rCutSmart™ Buffer CACNNN/GTG  
DrdI § rCutSmart™ Buffer GACNNNN/NNGTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
EaeI § rCutSmart™ Buffer Y/GGCCR  
EagI-HF® § rCutSmart™ Buffer C/GGCCG  
EarI § rCutSmart™ Buffer CTCTTC(1/4)  
EciI § rCutSmart™ Buffer GGCGGA(11/9)
Eco53kI § rCutSmart™ Buffer GAG/CTC  
EcoNI § rCutSmart™ Buffer CCTNN/NNNAGG  
EcoO109I § rCutSmart™ Buffer RG/GNCCY   
EcoP15I § NEBuffer™ r3.1 CAGCAG(25/27)  
EcoRI § NEBuffer™ EcoRI/SspI G/AATTC  
EcoRI-HF® § rCutSmart™ Buffer G/AATTC  
EcoRV § NEBuffer™ r3.1 GAT/ATC  
EcoRV-HF® § rCutSmart™ Buffer GAT/ATC  
Esp3I § rCutSmart™ Buffer CGTCTC(1/5)  
Enzyme Back to top Supplied NEBuffer Sequence Properties
FatI § @55°C NEBuffer™ r2.1 /CATG
FauI § @55°C rCutSmart™ Buffer CCCGC(4/6)
Fnu4HI § rCutSmart™ Buffer GC/NGC  
FokI § rCutSmart™ Buffer GGATG(9/13)  
FseI § rCutSmart™ Buffer GGCCGG/CC   
FspEI § rCutSmart™ Buffer CC(12/16)
FspI § rCutSmart™ Buffer TGC/GCA  
Enzyme Back to top Supplied NEBuffer Sequence Properties
HaeII § rCutSmart™ Buffer RGCGC/Y  
HaeIII § rCutSmart™ Buffer GG/CC  
HgaI § NEBuffer™ r1.1 GACGC(5/10)
HhaI § rCutSmart™ Buffer GCG/C  
HincII § NEBuffer™ r3.1 GTY/RAC  
HindIII § NEBuffer™ r2.1 A/AGCTT
HindIII-HF® § rCutSmart™ Buffer A/AGCTT  
HinfI § rCutSmart™ Buffer G/ANTC  
HinP1I § rCutSmart™ Buffer G/CGC  
HpaI § rCutSmart™ Buffer GTT/AAC
HpaII § rCutSmart™ Buffer C/CGG  
HphI § rCutSmart™ Buffer GGTGA(8/7)   
HpyAV § rCutSmart™ Buffer CCTTC(6/5)  
HpyCH4III § rCutSmart™ Buffer ACN/GT
HpyCH4IV § rCutSmart™ Buffer A/CGT  
HpyCH4V § rCutSmart™ Buffer TG/CA  
Hpy188I § rCutSmart™ Buffer TCN/GA  
Hpy99I § rCutSmart™ Buffer CGWCG/
Hpy166II § rCutSmart™ Buffer GTN/NAC  
Hpy188III § rCutSmart™ Buffer TC/NNGA  
Enzyme Back to top Supplied NEBuffer Sequence Properties
I-CeuI § rCutSmart™ Buffer TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI § rCutSmart™ Buffer TAGGGATAACAGGGTAAT(-9/-13)
Enzyme Back to top Supplied NEBuffer Sequence Properties
KasI § rCutSmart™ Buffer G/GCGCC
KpnI § NEBuffer™ r1.1 GGTAC/C
KpnI-HF® § rCutSmart™ Buffer GGTAC/C  
Enzyme Back to top Supplied NEBuffer Sequence Properties
LpnPI § rCutSmart™ Buffer CCDG(10/14)
Enzyme Back to top Supplied NEBuffer Sequence Properties
MboI § rCutSmart™ Buffer /GATC   
MboII § rCutSmart™ Buffer GAAGA(8/7)   
MfeI § rCutSmart™ Buffer C/AATTG
MfeI-HF® § rCutSmart™ Buffer C/AATTG  
MluCI § rCutSmart™ Buffer /AATT  
MluI § NEBuffer™ r3.1 A/CGCGT  
MluI-HF® § rCutSmart™ Buffer A/CGCGT  
MlyI § rCutSmart™ Buffer GAGTC(5/5)  
MmeI § rCutSmart™ Buffer TCCRAC(20/18)  
MnlI § rCutSmart™ Buffer CCTC(7/6)  
MscI § rCutSmart™ Buffer TGG/CCA  
MseI § rCutSmart™ Buffer T/TAA  
MslI § rCutSmart™ Buffer CAYNN/NNRTG  
MspA1I § rCutSmart™ Buffer CMG/CKG  
MspI § rCutSmart™ Buffer C/CGG  
MspJI § rCutSmart™ Buffer CNNR(9/13)
MwoI § @60°C rCutSmart™ Buffer GCNNNNN/NNGC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
NaeI § rCutSmart™ Buffer GCC/GGC
NarI § rCutSmart™ Buffer GG/CGCC
Nb.BbvCI § rCutSmart™ Buffer CCTCAGC
Nb.BsmI § @65°C NEBuffer™ r3.1 GAATGC
Nb.BsrDI § @65°C rCutSmart™ Buffer GCAATG
Nb.BssSI § NEBuffer™ r3.1 CACGAG
Nb.BtsI § rCutSmart™ Buffer GCAGTG
NciI § rCutSmart™ Buffer CC/SGG  
NcoI § NEBuffer™ r3.1 C/CATGG  
NcoI-HF® § rCutSmart™ Buffer C/CATGG  
NdeI § rCutSmart™ Buffer CA/TATG  
NgoMIV § rCutSmart™ Buffer G/CCGGC  
NheI-HF® § rCutSmart™ Buffer G/CTAGC  
NlaIII § rCutSmart™ Buffer CATG/  
NlaIV § rCutSmart™ Buffer GGN/NCC  
NmeAIII § rCutSmart™ Buffer GCCGAG(21/19)
NotI § NEBuffer™ r3.1 GC/GGCCGC  
NotI-HF® § rCutSmart™ Buffer GC/GGCCGC  
NruI § NEBuffer™ r3.1 TCG/CGA   
NruI-HF® § rCutSmart™ Buffer TCG/CGA   
NsiI § NEBuffer™ r3.1 ATGCA/T  
NsiI-HF® § rCutSmart™ Buffer ATGCA/T  
NspI § rCutSmart™ Buffer RCATG/Y  
Nt.AlwI § rCutSmart™ Buffer GGATC(4/-5)  
Nt.BbvCI § rCutSmart™ Buffer CCTCAGC(-5/-7)
Nt.BsmAI § rCutSmart™ Buffer GTCTC(1/-5)
Nt.BspQI § @50°C NEBuffer™ r3.1 GCTCTTC(1/-7)
Nt.BstNBI § @55°C NEBuffer™ r3.1 GAGTC(4/-5)
Nt.CviPII § rCutSmart™ Buffer (0/-1)CCD
Enzyme Back to top Supplied NEBuffer Sequence Properties
PacI § rCutSmart™ Buffer TTAAT/TAA  
PaeR7I § rCutSmart™ Buffer C/TCGAG  
PaqCI § rCutSmart™ Buffer CACCTGC(4/8)
PciI § NEBuffer™ r3.1 A/CATGT
PflFI § rCutSmart™ Buffer GACN/NNGTC  
PflMI § NEBuffer™ r3.1 CCANNNN/NTGG   
PI-PspI § @65°C NEBuffer™ PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)  
PI-SceI § NEBuffer™ PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)  
PleI § rCutSmart™ Buffer GAGTC(4/5)
PluTI § rCutSmart™ Buffer GGCGC/C
PmeI § rCutSmart™ Buffer GTTT/AAAC  
PmlI § rCutSmart™ Buffer CAC/GTG  
PpuMI § rCutSmart™ Buffer RG/GWCCY   
PshAI § rCutSmart™ Buffer GACNN/NNGTC  
PsiI-v2 § rCutSmart™ Buffer TTA/TAA  
PspGI § @75°C rCutSmart™ Buffer /CCWGG  
PspOMI § rCutSmart™ Buffer G/GGCCC  
PspXI § rCutSmart™ Buffer VC/TCGAGB
PstI § NEBuffer™ r3.1 CTGCA/G  
PstI-HF® § rCutSmart™ Buffer CTGCA/G  
PvuI § NEBuffer™ r3.1 CGAT/CG  
PvuI-HF® § rCutSmart™ Buffer CGAT/CG  
PvuII § NEBuffer™ r3.1 CAG/CTG  
PvuII-HF® § rCutSmart™ Buffer CAG/CTG  
Enzyme Back to top Supplied NEBuffer Sequence Properties
RsaI § rCutSmart™ Buffer GT/AC  
RsrII § rCutSmart™ Buffer CG/GWCCG
Enzyme Back to top Supplied NEBuffer Sequence Properties
SacI § NEBuffer™ r1.1 GAGCT/C  
SacI-HF® § rCutSmart™ Buffer GAGCT/C  
SacII § rCutSmart™ Buffer CCGC/GG  
SalI § NEBuffer™ r3.1 G/TCGAC  
SalI-HF® § rCutSmart™ Buffer G/TCGAC  
SapI § rCutSmart™ Buffer GCTCTTC(1/4)  
Sau3AI § NEBuffer™ r1.1 /GATC
Sau96I § rCutSmart™ Buffer G/GNCC  
SbfI § rCutSmart™ Buffer CCTGCA/GG  
SbfI-HF® § rCutSmart™ Buffer CCTGCA/GG  
ScaI-HF® § rCutSmart™ Buffer AGT/ACT  
ScrFI § rCutSmart™ Buffer CC/NGG  
SexAI § rCutSmart™ Buffer A/CCWGGT  
SfaNI § NEBuffer™ r3.1 GCATC(5/9)
SfcI § rCutSmart™ Buffer C/TRYAG
SfiI § @50°C rCutSmart™ Buffer GGCCNNNN/NGGCC   
SfoI § rCutSmart™ Buffer GGC/GCC   
SgrAI § rCutSmart™ Buffer CR/CCGGYG
SmaI § @25°C rCutSmart™ Buffer CCC/GGG  
SmlI § @55°C rCutSmart™ Buffer C/TYRAG
SnaBI § rCutSmart™ Buffer TAC/GTA
SpeI § rCutSmart™ Buffer A/CTAGT  
SpeI-HF® § rCutSmart™ Buffer A/CTAGT  
SphI § NEBuffer™ r2.1 GCATG/C
SphI-HF® § rCutSmart™ Buffer GCATG/C  
SrfI § rCutSmart™ Buffer GCCC/GGGC  
SspI § NEBuffer™ EcoRI/SspI AAT/ATT  
SspI-HF® § rCutSmart™ Buffer AAT/ATT  
StuI § rCutSmart™ Buffer AGG/CCT   
StyD4I § rCutSmart™ Buffer /CCNGG   
StyI-HF® § rCutSmart™ Buffer C/CWWGG  
SwaI § @25°C NEBuffer™ r3.1 ATTT/AAAT  
Enzyme Back to top Supplied NEBuffer Sequence Properties
TaqI-v2 § @65°C rCutSmart™ Buffer T/CGA   
TfiI § @65°C rCutSmart™ Buffer G/AWTC  
TseI § @65°C rCutSmart™ Buffer G/CWGC  
Tsp45I § @65°C rCutSmart™ Buffer /GTSAC
TspMI § @75°C rCutSmart™ Buffer C/CCGGG  
TspRI § @65°C rCutSmart™ Buffer NNCASTGNN/  
Tth111I § @65°C rCutSmart™ Buffer GACN/NNGTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
XbaI § rCutSmart™ Buffer T/CTAGA   
XcmI § NEBuffer™ r2.1 CCANNNNN/NNNNTGG
XhoI § rCutSmart™ Buffer C/TCGAG  
XmaI § rCutSmart™ Buffer C/CCGGG  
XmnI § rCutSmart™ Buffer GAANN/NNTTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
ZraI § rCutSmart™ Buffer GAC/GTC
Loading Spinner